Poster abstracts

Poster number 47 submitted by Sheng Liu

Biophysical studies of RNA binding by the ACB domain of human lysyl aminoacyl tRNA synthetase

Sheng Liu (Department of Chemistry, University of Cincinnati), Christopher Jones (Departments of Chemistry and Biochemistry, The Ohio State University), Karin Musier-Forsyth (Departments of Chemistry and Biochemistry, The Ohio State University), Michael Howell (ProteinExpress), Pearl Tsang (Department of Chemistry, University of Cincinnati)

Abstract:
Human LysRS is a class IIb synthetase that relies upon its anticodon binding (ACB) domain for specific recognition and binding to cognate tRNA (Tamura et al., 1992). The focus of this research is to characterize ACB domain binding to various RNAs on a molecular level using NMR and other techniques. In order to characterize ACB interactions with these RNAs at high resolution, the NMR resonances of the ACB protein were first assigned using standard three-dimensional solution NMR methods using an ¹⁵N- and ^13C-labeled form of this protein. With these resonance assignments, we have mapped the ACB protein surface that is affected by RNA binding via NMR chemical shift perturbation techniques. The RNA molecules studied this way include: a) an oligonucleotide corresponding to the anticodon stem loop of tRNA^Lys,3 (‘ACSL’), b) (UUU)₃ (‘oligoU’), c) (CCC)₃ (‘oligoC’), d) CCCAGACCCUUUUAGUCAGUGGG (‘TLE²³’), e) CCCAGACCCAAAAAGUCAGUGGG (‘TLE²³-4A’), and f) CCCAGACCCCCCCAGUCAGUGGG (‘TLE²³-4C’). Considerable overlap was observed in terms of the ACB surface affected by RNA binding for the ACSL, oligoU and TLE²³ RNAs. These RNAs share a ‘UUU’ sequence motif that is a critical molecular determinant of RNA anticodon binding by the ACB. The TLE sequences, derived from a region 5’ to the primer binding site of the HIV-1 RNA genome, are studied relative to oligoU and ACSL RNAs because of its potential function as a mimic of the tRNA^Lys,3 anticodon loop. The TLE was recently proposed to compete against tRNA^Lys,3 for interaction with the human LysRS (Jones, et al., submitted) which is important for proper primer binding and reverse transcription during the HIV-1 life cycle. Details regarding how these RNAs interact with the ACB as well as possible implications of such an observed common binding surface will be provided and discussed.

References:
K. Tamura, H. Himeno, H. Asahara, T. Hasegawa and M. Shimizu (1992) In vitro study of E. coli tRNAArg and tRNALys identity elements. Nucleic Acids Research 20(9):2335-2339
C. Jones, J. Saadatmand, L. Kleiman and K. Musier-Forsyth (2011) submitted to PLOS Pathogens, Molecular mimicry of human tRNA^Lys,3 by HIV-1 RNA genome facilitates viral replication

Keywords: Anticodon binding domain of LysRS, HIV-1, tRNAsupLys,3sup